Introduction

This is a simple program to aid in designing of primers and creation of primer sheets. For proper instruction on how to create primers for QuickChange Site-Directed Mutagenesis, look at the Primers page. The program allows users to select a background and enter mutaions. An initial primer is then suggested. User can manipulate the selected primer to add or remove nucleotides from either 5’ or 3’ ends. A set of parameters reflecting the goodness of the primer is updated on the fly, as the user makes changes. Once happy with the primer, the information is saved in a primer sheet, which can then be uploaded to the BGME lab primer database on the Wiki.

Requirements

Python 2.5 or later

Download

sourceforge.net/projects/primer-design/
For the latest changes and updates, please visit the PrimerDesignerReleaseNotes

License

GPLv3: www.gnu.org/licenses/gpl.html

Installation

  1. Unpack the downloaded archive into a directory. The following files will be copied:
    • PrimerDesigner.py
    • dialog.py
    • tkModule.py
    • utils.py
    • data.in
    • README
    • LICENSE
  2. If installing on Linux or a Mac, make sure that data.in file has write permissions.
  3. Run the program by double-clicking on PrimerDesigner.py.

Initialization data

The Primer Designer is initialized with the data contained in data.in file. This file contains basic settings and predefined background sequences. For the full description of the data.in file, please look in PrimerDesignerDataIn.

Usage

Background/Mutations Entry Form

The first window to appear, is displayed below.

Mutations dialog
  1. Enter your initials.
  2. Select appropriate background. If your background is not one of the pre-defined ones, see steps 2.1 – 2.5, otherwise go on to step 3. In the case where you background contains additional mutaions (i.e. D+PHS/D21N), you should enter D21N as a current mutaion in step 4.
    1. Click on add new background, select other from the backgrounds list.
    2. Enter new background name in to the newly displayed text box.
    3. Click on “Add new background”.
    4. Enter DNA sequence either by pasting it into the newly displayed text box, or click on “Load Sequence File”. If loading from the file, the inout data needs to be in the FASTA format.
    5. In the cases where deleted residues produce a gap in the residue index in the background (i.e. delta in D+PHS - 44-49, enter the deleted residues in the text box labeled “Delected residues”. The format of this text is of the type: "4,5,44-49" (no quotes).
  3. Add current mutations. These are mutations that are present in you background protein in addition to the background selected in step 3. For example if using background D+PHS/D21N, the D+PHS is the background, and D21N is the current mutation.
    1. Click on “Add current mutation” to add a mutation. Three small text boxes will appear.
    2. Enter single letter for the residue present in the background in the left box, the residue index into the middle box, and target residue type into the right box. For example enter D21N as |D|21|N|.
    3. If more mutations need to be entered, go to step 3.1.
  4. Add new mutations. These are the mutations that will be introduced by the primer.
    1. Click on “Add new mutation” to add a mutation. Three small text boxes will appear.
    2. Enter single letter for the residue present in the background in the left box, the residue index into the middle box, and target residue type into the right box. For example enter V23E as |V|23|E|.
    3. If more mutations need to be entered, go to step 4.1.
    4. Click Next.

Plasmid Design Form

The following dialog window will appear. The exact information will differ depending on the background, current mutations and new mutations selected.

Mutations dialog
  1. Change codon for current mutation. If necessary, use the drop down menu to change the current mutation codon. Once the desired codon is selected, click on "Update mutation codon".
  2. Change codon for new mutation. If necessary, use the drop down menu to change the new mutation codon. Once the desired codon is selected, click on "Update mutation codon".
  3. Add/Remove nucleotides. Enter the number of nucleotides on the left and/or the right to add or remove. To add that number of nucleotides, click "Add", to remove that number of nucleotides, click "Delete".
  4. Summary checks. While designing the primer, keep an eye on the Summary Checks and Information. The parameters highlighted in green show the optimal values, those in red indicate room for improvement. The values appearing in yellow, are something to keep in mind, but they should not stop you from moving forward.
  5. Select Compatible Backgrounds. Select compatible backgrounds by placing a check in the appropriate box.
  6. Final Primer. The final primer is displayed at the bottom of the window. This can be selected and copied to the IDT website for ordering.
  7. Generate Primer Sheet. Click "Next" to generate the primer sheet for the BGME database. An example is shown below:

Example Primer Form

Primer name: D+PHS_D21N_V23E
Date       : 2011-1-31
User       : cd
 
IDT Primer : GATGGTAATACGGAAAAATTAATGTACA
 
=========================================================
TABLE 1. Background protein used to design primer
=========================================================
Background:        D+PHS
Current Mutations: D21N
Primer location:   
 
Relevant Segment of Background Sequence
GAT GGT AAT ACG [GTT] AAA TTA ATG TAC A 
ASP GLY ASN THR [VAL] LYS LEU MET TYR LYS
19                                    28
 
=========================================================
TABLE 2. New mutations to be introduced
=========================================================
V23E: GTT->GAA
 
Primer/Compliment sequence
5' GAT GGT AAT ACG [GAA] AAA TTA ATG TAC A 3'
3' CTA CCA TTA TGC [CTT] TTT AAT TAC ATG T 5'
 
=========================================================
TABLE 3. Both strands written 5' to 3'
=========================================================
5' GAT GGT AAT ACG [GAA] AAA TTA ATG TAC A 3'
5' T GTA CAT TAA TTT [TTC] CGT ATT ACC ATC 3'
 
=========================================================
TABLE 4. Spec data for new primer
=========================================================
* # BP in primer:     28
* Tm (Stratagene)(C): 62.07
* GC Content (%):     28.57
* Sequence covered:   ASP-19 to LYS-28
* # Residues covered: 10
* Comp. Backgrounds:  None selected
 
=========================================================
TABLE 5. WARNING: Flagged items
=========================================================
* 3' does not end on G or C
* Row of poly A,T,C,G nucleotides (>=4): A
* 5' can non-specifically bind the sense DNA strand
* 3' can non-specifically bind the sense DNA strand
* 3' end is GC rich: 1
* Diff. in Tm between 5' and 3' > 5C: 5.78


Bugs

Please submit bugs to the SourceForge tracker on SourceForge Tracker Form



Categories
CategorySoftware
There are no comments on this page.
Valid XHTML :: Valid CSS: :: Powered by WikkaWiki